DNA

Wat is DNA?

In cellen van mensen en dieren zitten lange dunne slierten van chemische stofjes die aan elkaar vastzitten. Deze slierten worden DNA genoemd. Elke sliert is opgerold en vormt zo een chromosoom.

Wat doet DNA?

Het DNA bevat erfelijke gegevens die door de ouders worden overgedragen op hun kinderen. Dus allerlei lichaamskenmerken, zoals huidskleur, kleur van de ogen, lichaamslengte etc. zijn vastgelegd in dit DNA. De manier waarop dit is vastgelegd wordt bepaald door de volgorde van de chemische stofjes waaruit het DNA is opgebouwd.

Hoe is het opgebouwd?

De chemische stofjes waaruit het DNA is opgebouwd worden ‘basen’ genoemd. Er zijn vier van dit soort basen, namelijk adenine, cytosine, thymine en guanine. Deze worden vaak afgekort tot respectivelijk A, C, T, en G. Een sliert DNA kan als volgt worden weergegeven:

ATTGCAACGTAACGAAGGTCATGCCAGGTTAACTGA

Dit is maar een piepklein stukje DNA. Het totale DNA van een mens bevat ongeveer drie miljard van deze basen achter elkaar. In groepjes van drie vormen de basen als het ware een code, dus bijvoorbeeld ‘CGA’. Deze code wordt gebruikt als recept om eiwitten te maken. Eiwitten zijn opgebouwd uit aminozuren. Elk aminozuur heeft een eigen code.

Hoe bepaalt DNA de erfelijke kenmerken?

De sliert DNA kan worden onderverdeeld in ‘genen’. Elk ‘gen’ codeert voor een bepaald eiwit. Mensen hebben in totaal ruim 20.000 genen. Die coderen dus allemaal voor verschillende eiwitten in het menselijk lichaam. Al deze eiwitten hebben verschillende functies in het lichaam.